EST details — SGN-C185871

Search information 
Request: 185871Match: SGN-C185871
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185871Clone name: TUS-48-I5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185871 is on microarray TOM1 spot ID 1-1-4.1.7.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C409 [cLEB-3-F20] Trace: SGN-T22912 EST: SGN-E203166 Direction: 5' Facility: TIGR
Clone: SGN-C409 [cLEB-3-F20] Trace: SGN-T22913 EST: SGN-E203167 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376222Length: 913 bp (untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E376222 [] (untrimmed)
AGCTATCGCCANCTCGNAATTACCCTACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCCAGGCAAATTCTGTTTTATCAGACC
GCTTCTGCGTTCTGATTTAATCTGTATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACAGCTTCGGCGTTGTAAGGTTAAGCCTCACGGTTCAT
TAGTACCGGTTAGCTCAACGCATCGCTGCGCTTACACACCCGGCCTATCAACGTCGTCGTCTTCAACGTTCCTTCAGGACCCTTAAAGGGTCAGG
GAGAACTCATCTCGGGGCAAGTTTCGTGCTTAGATGCTTTCAGCACTTATCTCTTCCGCATTTAGCTACCGGGCAGTGCCATTGGCATGACAACC
CGAACACCAGTGATGCGTCCACTCCGGTCCTCTCGTACTAGGAGCAGCCCCCCTCAGTTCTCCAGCGCCCACGGCAGATAGGGACCGAACTGTCT
CACGACGTTCTAAACCCAGCTCGCGTACCACTTTAAATGGCGAACAGCCATACCCTTGGGACCTACTTCAGCCCCAGGATGTGATGAGCCGACAT
CGAGGTGCCAAACACCGCCGTCGATATGAACTCTTGGGCGGTATCAGCCTGTTATCCCCGGAGTACCTTTTATCCGTTGAGCGATGGCCCTTCCA
TTCAGAACCACCGGATCACTATGACCTGCTTTCGCACCTGCTCGCGCCGTCACGCTCGCAGTCAAGCTGGCTTATGCCATTGCACTAACCTCCTG
ATGTCCGACCAGGATTACCCAACCTTCGTGCTCCTCCGTTACTCTTTAGGAGGAGACCGCCCCAGTCAAACTACCCACCAGACACTGTCCGCAAC
CCGGATTACGGGTTCAACGTTAAAACATTAAACCTTAAAGGGTGGGTTTTCAGGGGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T188262 [Download][View] Facility Assigned ID: FA0AAD36AE03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: E. Coli (cloning host) sequence detected
Sequence Entropy: 0.988 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5