EST details — SGN-C185965

Search information 
Request: 185965Match: SGN-C185965
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185965Clone name: TUS-48-M3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185965 is on microarray TOM1 spot ID 1-1-6.1.7.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C74055 [cLER-7-J2] Trace: SGN-T93506 EST: SGN-E281043 Direction: 5' Facility: TIGR
Clone: SGN-C185965 [TUS-48-M3] Trace: SGN-T188197 EST: SGN-E376157 Direction: 3' Facility: INRA
Clone: SGN-C185965 [TUS-48-M3] Trace: SGN-T188198 EST: SGN-E376158 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378239Length: 406 bp (1149 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378239 [] (trimmed) CCAATTTGAATCTTCAATCCTAGTCCTTAGGCTATTCATATGTGTAATGAAAGGATTCTTCCTCTTGCAAAAAAAAAAAAAAAAAAAAAAAAAGG
TTTGCCCGGCCGGGGGGCCCCCCCAAGGCCAAGGAAAAAGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAAAAGGGGACAAAAAAAAAAAA
CTGGGCCTTGTTCCCCTGTTGGGTGCAAAAAAAAATCCCCAAAGGGGGTTAAAAAAAAAAAAAAATTGAAAAAGGGGGAATTAAAAAATTTTTCC
CCCCCAAAAAATTTTTTTTTTCAGGGGGTTAAAGAAAAAAAAAAAAAAATAAAGGGGGGGGGGGCAAAAAAAAACCCGGCCGGGGGGGCCCATAA
AAAAAGGGGGCCCCCCCGGGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378239] SGN-U592922 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1915 [Download] [View] Facility Assigned ID: TUS48M3.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.835 Expected Error Rate: 0.0247 Quality Trim Threshold: 20.5