EST details — SGN-E186283

Search information 
Request: 186283Match: SGN-E186283
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96619Clone name: cLEY-16-M7
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C96619 [cLEY-16-M7] Trace: SGN-T120064 EST: SGN-E307710 Direction: 5' Facility: TIGR
Clone: SGN-C192964 [TUS-66-P18] Trace: SGN-T345452 EST: SGN-E544577 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E186283Length: 567 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E186283 [] (called/trimmed by facility)
GGTTCCAAAGGATGCGGTTGAGGATTGGCCTGAACCTAAGCAGGTCCATTCGTTCTATACTGTTAAATTTCGGAGATTTGACGACCCTAAACTGA
AAGCCAGAATTGAACTGGCTGAAAAAGAGCTACAGAAAAAGAACCAAGCTAGATCTCAGATCATTGAAAAATTGAAGGCCAAAAGGATTTTTACC
ATGTGTTGCTGCGTTGAACTGGAAGTATTATAAAGTCAAAATGAAAGATCTTGTTATCCTACAGTTTTAACTAATTTCTGCAAATTCAGCAAGCT
TTCGCTGAAAAATCAATTTTCATTGAACAAAGGAAAGCCCTCAGTGCTGAGAATAAGGAATTTCGGAGTGCTATTGATGGTAAGATAAAGGAAAT
GGCACCTCTGCATGAGGCTTTGGGCCAGCTCCGCGGTTCTAGGAATGCAGGCCGAGAGAGGGGTCCTACAGTGTGTTCATCTGAGGAGGAGCTCA
ATCATCTTATCAAGGGTCTGCAATACCGCATTCAGCATGAAAGCATTCCTCTGAACGAAGAGAAGCAAATTCTTCGGGAAATCAAACAACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T120064 [Download] [View] Facility Assigned ID: TRYCI76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence