EST details — SGN-E187459

Search information 
Request: 187459Match: SGN-E187459
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37891Clone name: cLEG-43-H5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37891 [cLEG-43-H5] Trace: SGN-T72588 EST: SGN-E259226 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E187459Length: 610 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E187459 [] (called/trimmed by facility)
TCCAGGGCCCAAGATTAATAAAGATGGTGCACTTCAAATGCTTGCTACAAATATTGAGTGTGAAGAACATAAAGGGCGCATAGCTATTGGACGTG
TGCATGCTGGAAGTCTGCGCAGGGGAATGGATGTGAAGATATGTACATCTGAAGACGCATGCAGATTCGGCAGAGTAAGTGAGTTATTTGTGTAT
GAGAAATTCAGTAGAGTTCCTGCTGAAACTGTTGAAGCTGGAGATATTTGTGCGGTGTGTGGCATTGATGATATTCAGATCGGAGAGACTATCGC
TGACAAAAGCGATGGAAAACCATTACCTTCAATCAAGGTTGAAGAACCTACAGTGAAAATGTCATTTTCAGTCAATACATCCCCCTTTGTTGGCC
GTGAGGGAAAGTATGTTACTAGTCGAAACCTAAGAGACCGGTTGTACCGTGAGCTGGAAAGAAATCTGGCAATGAAAGTTGAAGATGGTGAAACT
GCAGATACGTTCATTGTCAGTGGACGTGGTACTTTGCATATTACCATCCTGATAGAGAACATGCGAAGGGAAGGATACGAGTTCATGGTGGGACC
TCCTAAAGTGATAAATAAGAGAGTGAACGACAAGTTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T72588 [Download] [View] Facility Assigned ID: TBFGO39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence