EST details — SGN-E189672

Search information 
Request: 189672Match: SGN-E189672
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23526Clone name: cLED-5-K14
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174757 is on microarray TOM1: SGN-S1-1-6.2.15.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23526 [cLED-5-K14] Trace: SGN-T49633 EST: SGN-E231017 Direction: 5' Facility: TIGR
Clone: SGN-C174757 [TUS-19-J3] Trace: SGN-T189439 EST: SGN-E376825 Direction: 3' Facility: INRA
Clone: SGN-C174757 [TUS-19-J3] Trace: SGN-T189440 EST: SGN-E376826 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E189672Length: 361 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E189672 [] (called/trimmed by facility)
CACGTCGCACCTCTCCGCCACAACTCTCATCGTCACTACCTCACAACTCTATAAACTTCAGCCACTCACCATATTCGGAATGGGATTGGAGTTCT
AGGATAATGTTTTTGACTTCTCATCTATTTGAAAAATGAACTCACGTCACCTCTTTGGATTTTCTCATCTGAATCTTCACAAATCTAAGAAGACT
CTGAGAAGCTTGTACGTCCTGCACAATGGCGTTTATATGTAGTTCTCATTGTTGTTGTCGTCTTAGAATTTTCTGTTGTTGAGGGACCTATAGGG
GATATAGCCATAACTTATCCACAGGAGTAAAGCTTGAGAAGGAAGATGGTGGTATTCCAAGGGTCAAACAATTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T49633 [Download] [View] Facility Assigned ID: TOVAR67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence