EST details — SGN-E190848

Search information 
Request: 190848Match: SGN-E190848
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23322Clone name: cLED-5-B2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174629 is on microarray TOM1: SGN-S1-1-6.4.15.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23322 [cLED-5-B2] Trace: SGN-T49683 EST: SGN-E231067 Direction: 5' Facility: TIGR
Clone: SGN-C174629 [TUS-19-D19] Trace: SGN-T189418 EST: SGN-E376804 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E190848Length: 323 bp (called/trimmed by facility)
Status: Legacy Direction: 5' [See links to 3' reads above]
>SGN-E190848 [] (called/trimmed by facility)
ATGAGATTACCTACAAATAATGAGAGTTTGAGAGTTGGAAATGAAGTAGAGTGTGAAAATGGTTGTTTGGAGGATTGTGATTGTGTTGGTTATGC
TTATGGTAATGGAAATATTGGGTGTTTGATATGGAAAAGGGAGATGTTGAATTTGCAACAACTTGCTCAAGATAATGTTAATGGAAGCACCATTT
ATGTTAGGCTTGCATCTTCTGAGTTTTCAAGTAACCAAGATCAAAAGCAAACTTCAACAAAGCTGAAAATTGCAATTCCTATAGGTGTAATTGCT
GCACTTCTCATTCTATCATGCTTTTTTATATACTATAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T49683 [Download] [View] Facility Assigned ID: TOVAT01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence