EST details — SGN-E192430

Search information 
Request: 192430Match: SGN-E192430
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23863Clone name: cLED-6-I5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175020 is on microarray TOM1: SGN-S1-1-7.1.14.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23863 [cLED-6-I5] Trace: SGN-T50215 EST: SGN-E233229 Direction: 5' Facility: TIGR
Clone: SGN-C175020 [TUS-20-E2] Trace: SGN-T189897 EST: SGN-E377686 Direction: 3' Facility: INRA
Clone: SGN-C175020 [TUS-20-E2] Trace: SGN-T189898 EST: SGN-E377687 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E192430Length: 522 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E192430 [] (called/trimmed by facility)
CCGAAACCAGCTCCATCTCCTCCATCGCCAGTCAAGCCACCTACTACTTGTGATGATATGTACAGTTGCCCATCAGGAACAACGTGTTGCTGTGT
CTACGAGTACTATCACATGTGCTTTGCTTGGGGTTGCTGCCCTATGGAAGGAGCTACTTGCTGTAAAGACCATAACAGTTGCTGCCCACATGATT
ATCCTGTCTGCAATGTTAAAGCCGGCACCTGCTCAATCAGCGAGAATAACCCTCTTTCAGTCAAAGCAATGTCACACATTCTTGCCAAACCTATT
GGATCCTTCAGCAATCAGGGAATGAAAAACACTATCTCTTGAAGTGTCTCCAATGGGAATGCGCAAATTCGCAGTGAATTTGCAAAACCTCATTT
CCAGCTGAAAGTTTATAGTTATAGGTGATTCCAAAAGCAGAGGATAACAGAGTTGCTGCTGATTTCTGTATAGTGCTTCTTTAGTGCTTGTCACA
CAATGCACTAGAACAATATTGAAACAAGATTTCATTGGTCTGCTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T50215 [Download] [View] Facility Assigned ID: TOVAU51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence