EST details — SGN-E193654

Search information 
Request: 193654Match: SGN-E193654
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C104123Clone name: cLPP-13-A4
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C104123 [cLPP-13-A4] Trace: SGN-T173471 EST: SGN-E361068 Direction: 5' Facility: TIGR
Clone: SGN-C194633 [TUS-71-F7] Trace: SGN-T348319 EST: SGN-E547444 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194633 [TUS-71-F7] Trace: SGN-T348320 EST: SGN-E547445 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E193654Length: 461 bp (called/trimmed by facility)
Status: Legacy Direction: 5' [See links to 3' reads above]
>SGN-E193654 [] (called/trimmed by facility)
GGTTACTGGGGCTGAAACAGAGGTCCTTCAATGGCTGACTCCGTGACAGCTCCAGCGACTTACGGGACTCAAGCCGATGCTTTGCTTAGGAAGAA
TTTGACGTTTCAGAAACGAAATGTCAAGACAAATGTTCGCCTCATCTTAGTCCCTATTTCACTCCTTCTTTTAATAAGGGCCATTGAATTCTCGA
GTACAGTGATGACGGCCAAAGACAGTAAATGTGGCTGCCAATGTGTCGACAAAAATGGTACAGGAAAATGTGTAAAAGAATGTGGTCTGCAATAC
TCAAATCCGTTACAAGCAGCAAGTTGTGAAGTTAAAGAACCATATGAATGGCATCCTGTTTTCCAGTTACCAGAACCTCAATTTAGTGCTGTAAA
ATCTGATGTTATTACATATCCAGACTTGCCTAATGAGTCATGCAGAGACTCTAATTCTTGTCCAGCTATTATACTAGTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T173471 [Download] [View] Facility Assigned ID: TPOBX02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence