EST details — SGN-E196849

Search information 
Request: 196849Match: SGN-E196849
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106353Clone name: cLPP-20-O3
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C106353 [cLPP-20-O3] Trace: SGN-T177400 EST: SGN-E364272 Direction: 5' Facility: TIGR
Clone: SGN-C194866 [TUS-71-O24] Trace: SGN-T348719 EST: SGN-E547844 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194866 [TUS-71-O24] Trace: SGN-T348720 EST: SGN-E547845 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E196849Length: 367 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E196849 [] (called/trimmed by facility)
GACCATTTTCACTTTCTCTTGTTTGTTGTCATCTCAATCTCAGACAACACAAGAGAAAACAAAAGGATCAGTTGGGGAAGATATACATACTAATT
ATACCTATACATATATATTGTTTTGGGTATCAATTCTTGATCCATTTTTTGCACAAATTTCTGTCCCTGTTTAATAATTTTGAGTGAAAATGTCA
AAAGAAATTGAAATGGGTGTTGATCACACCGAACCCGAACCCGAACCCGAAGAATCTTCTCCTCTGATCCCTCCTACTGTAATTACTGTACCTAA
TATTAATGATGATGATGATATTATAGACCTTGAAGCAGGTCCTGATGAACATATTCAATGCCGTATTTGCCTCGAATCTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T177400 [Download] [View] Facility Assigned ID: TPOCY86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence