EST details — SGN-E199898

Search information 
Request: 199898Match: SGN-E199898
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C104898Clone name: cLPP-16-G20
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C104898 [cLPP-16-G20] Trace: SGN-T176363 EST: SGN-E363981 Direction: 5' Facility: TIGR
Clone: SGN-C194728 [TUS-71-J6] Trace: SGN-T348482 EST: SGN-E547607 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194728 [TUS-71-J6] Trace: SGN-T348483 EST: SGN-E547608 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E199898Length: 411 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E199898 [] (called/trimmed by facility)
GCACAAACACACCTGCTCTTACCCAAGCTAATTCCCCCCCTATGATTAGGCAGGGAAAATCACTAAGCGAATACACGATGATTCGCCCATAATTT
CAATTTCTTCGCGCGCTTGGATGCATCATCTATCCTCTTGCAGGATGATGAGCATGAAGAGCGCGAAAACGGAGAAAAAAGGGACAATTTTGTTG
CATAAATATGAGATTGGTAAATTGTTAGGGCAAGGTACATTTGCCAAAGTTTATTATGCAAGGAACCTAAAAACAGGACAAATTGTAGCTGTTAA
GGTAATTGACAAAGAAAAAGTGATGAAAGTTGGCTTAATTGACCAAATCAAACGTGAAATTTCTGTTATGAGATTAATTAGGCATCCAAATGTTG
TTGAACTGTATGAAGTAATGGCTAGCAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T176363 [Download] [View] Facility Assigned ID: TPOCJ46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence