EST details — SGN-E201594

Search information 
Request: 201594Match: SGN-E201594
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1383Clone name: cLEC-11-O1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173070 is on microarray TOM1: SGN-S1-1-5.3.20.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173070 [TUS-15-C20] Trace: SGN-T188709 EST: SGN-E375855 Direction: 3' Facility: INRA
Clone: SGN-C173070 [TUS-15-C20] Trace: SGN-T188710 EST: SGN-E375856 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201594Length: 348 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201594 [] (trimmed) GATACAACTTTGATAGGTCACATATATTTGCTGTTAACATGCTTGAAGACATTGATAAGTTCCTGAAAGTTTCAGCTGAGTGGGCTCCACCATAG
ATCAAGCCTTATGTTCCAGGGGAGATGCTCCAAAAGAGGTTTACTGATGACAAATCTAGATATCAGTGTGTGATCCGGTCTGGCTGTGACACAGA
GGTACTCTGTAATGATGCAAGACGATTGAAGCCTGGGCTGGGGTATAAACTTCCTTAATGGACTGAGAGGTGAGAACAATGGTGCCCTATGGGTG
CTTACTTGTCAACAGATTACACACAAGGCGCTGTGATTTGGGGTGGAGCCAGCACTTTCAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201594] SGN-U588461 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25541 [Download] [View] Facility Assigned ID: TCABO85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0368 Quality Trim Threshold: 14.5