EST details — SGN-E202037

Search information 
Request: 202037Match: SGN-E202037
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14379Clone name: cLEC-7-L23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172964 is on microarray TOM1: SGN-S1-1-7.3.20.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T1265 EST: SGN-E378743 Direction: 5' Facility: Giov. Lab
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195259 EST: SGN-E393933 Direction: 5' Facility: INRA
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195259 EST: SGN-E399549 Direction: 5' Facility: INRA
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195410 EST: SGN-E394084 Direction: 5' Facility: INRA
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195798 EST: SGN-E394472 Direction: 3' Facility: INRA
Clone: SGN-C172964 [TUS-14-O10] Trace: SGN-T195798 EST: SGN-E399103 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202037Length: 437 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202037 [] (trimmed) AGATACTACGTGTGAAGCTTTATTTTGCTTTTCTTTTATTTCCTTGTAATCGTTCTATTTTTTGTATTCTCTTTTTTTAAAATTTATATCCCTTT
GTAATGAACTATGTATGACCTGAATTCTCAAGAATGAGATACATAGGCAGCCTATGTTGGCATCGGTCACCTCTTTCATCCCTTTAAATATTTAT
TTGAATTTGAACTATGTTCGATGTGAACTCTCAAAAATGAGATACGTAGGCGGTCTATTGTCGGTCTCGGTCGGTTTCTTTGTAAATGCCTTATT
ATTGTCAGCCTTGAGAGGAACTGTGTTTGACCTGATTCCTGCCTCAAGGGGATATTTAGGCACCACAAGGGTTCGATAATATTTCCCATAAGATT
TCTATTCCTCTTTATAATAGAAACTAGGACAGAATTTTTGAGAGGGACTCAAAAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202037] SGN-U579006 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25319 [Download] [View] Facility Assigned ID: TCABA72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0104 Quality Trim Threshold: 14.5