EST details — SGN-E202405

Search information 
Request: 202405Match: SGN-E202405
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C11044Clone name: cLEC-6-P8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172853 is on microarray TOM1: SGN-S1-1-6.2.20.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172853 [TUS-14-J19] Trace: SGN-T195900 EST: SGN-E394574 Direction: 3' Facility: INRA
Clone: SGN-C172853 [TUS-14-J19] Trace: SGN-T195901 EST: SGN-E394575 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202405Length: 330 bp (787 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202405 [] (trimmed) CAGGGAAAGGCCTCTGTTGGAGTTGCTGCAGCTAAGTATCATACAATTGTTCTTGGATCTGATGGAGAGGCTTAAACTTGGGGTCATCGGCTAGA
TACTCCAAAAAGAGTTGTGACTGGACGGTCCCTAAAAAAGATGGGCAACATCCCAATGAAGTTACATCTTAAGGAACGTCTTCATGTGGTTGCAA
TAGCTGCCGGGAATACACATAGTGTGGCTCTTACAGAGGACGGCACATTATTTTACTGGGTGTCATCTGATCCTGATCTGCGTTGCCAACAGTTA
TATTCACTATGTGGCACAAATGTAGCATGCATCTCTGCTGGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202405] SGN-U601714 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24066 [Download] [View] Facility Assigned ID: TCAAX88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0252 Quality Trim Threshold: 14.5