EST details — SGN-E202503

Search information 
Request: 202503Match: SGN-E202503
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10800Clone name: cLEC-6-F1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172683 is on microarray TOM1: SGN-S1-1-8.3.20.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172683 [TUS-14-C17] Trace: SGN-T195104 EST: SGN-E393778 Direction: 3' Facility: INRA
Clone: SGN-C172683 [TUS-14-C17] Trace: SGN-T195739 EST: SGN-E394413 Direction: 3' Facility: INRA
Clone: SGN-C172683 [TUS-14-C17] Trace: SGN-T195739 EST: SGN-E398910 Direction: 3' Facility: INRA
Clone: SGN-C172683 [TUS-14-C17] Trace: SGN-T199581 EST: SGN-E398255 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202503Length: 495 bp (615 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202503 [] (trimmed) AAAGAGACCACTGACAGTATTTGGTTTTGACGATGCACCTCATGGGCATGCGGAAATATTTTTTGAGAATGTATCCGTCCCTGCGAACAATATTC
TACTCGGTGAGGGGCGTGGCTTTGAGATTGCCCAGGGTAGGCTAGGTCCTGGAAGGTTGCATCATTGCATGAGGCTAATAGGTGCAGCCGAACGC
GGCATGCAGATGATGGTTCAACGGGCTCTTGAAAGACGAGCTTTTGGAAAATTAATTGCCAAACACGGTGCATTCCTTTCGGATGTTGCCAAATG
TCGAATTGAACTAGAGAAAACCAGATTACTGGTTCTGGAAGCTGCTGATCAGCTTGACCGCCTCGGAAACAAAAAGGCTCGTGCTACAATCGCGA
TGGCAAAGGTCGCTGCACCAAACATGGCATTGATGGTTCTCGATACTGCAATGCAAGTGCACGGTGCTGCTGGTGTATCCGGCGATACTGTTCTT
GCTCATCTCTGGGCTACTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202503] SGN-U569454 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24164 [Download] [View] Facility Assigned ID: TCAAW25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5