EST details — SGN-E202629

Search information 
Request: 202629Match: SGN-E202629
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3138Clone name: cLEC-19-L4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181885 is on microarray TOM1: SGN-S1-1-6.3.10.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181885 [TUS-38-C3] Trace: SGN-T194509 EST: SGN-E393183 Direction: 3' Facility: INRA
Clone: SGN-C181885 [TUS-38-C3] Trace: SGN-T194510 EST: SGN-E393184 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202629Length: 543 bp (846 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202629 [] (trimmed) AGTTCCTACAGTTATAATAACAAACAACAATTTCTACCAAAGTTTTTCAAATTCTAAATTTCATCAAAAAAACAACAACAATGGTGGTCTTAACA
AAACCTGCCATTACTCACTTCCCTATAGTGAAAAACTCTTTCAAATCACCCTCTTACATCAATGATATCCCTGTAATAGACCTCTCTAAAGCCAA
CTCCAAGAACCTCATCGTTAATGCCTGCGAAGAATTCGGATTCTTCAAAGTCATAAACCATGATGTTCCTATGGAATTCATAAGTAAACTCGAAT
CCGAAGCCGTTAAATTCTTCTCCTCTCCCCTCTCTGAGAAACTAAAGGCAGGGCCTGCTGATCCTTTTGGTTATGGCAATAAGAAAATCGGACAA
AATGGCGATATCGGTTGGGTTGAATACATTCTCCTTTCAACAAATTCTGAATTCAATTACCAGAAATTCGCATCTGTATTAGGTGTCAATCCAGA
AAACATTCGGGCTGCGGTGAATGATTATGTGTCATCAGTGAAGAAAATGTCATGTGAGATTCTTGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202629] SGN-U578575 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27470 [Download] [View] Facility Assigned ID: TCACX62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5