EST details — SGN-E203167

Search information 
Request: 203167Match: SGN-E203167
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C409Clone name: cLEB-3-F20
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: Alias clone SGN-C185871 is on microarray TOM1: SGN-S1-1-4.1.7.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C409 [cLEB-3-F20] Trace: SGN-T22912 EST: SGN-E203166 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203167Length: 463 bp (599 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203167 [] (trimmed) CAAGTGTATGTTAAATAATTTTTCATTTGCCAAATATTTGCATTATGAATGAATGATTGAGTGGTACAAAGCTACAAAGTCGATATGTGAAAAAA
ATTTAAGATCCAGGAACAAACTTAGTTGCGTAAACCCATGCATTGTTAGCAACAGGGTTGTCAAGGTGATCCAATAGATTTTCAAGTGGGCCTTT
GCCGGTGACAATAGCTTGAACGAAGAATCCAAACATGGAGAACATAGCTAATCTTCCGTTCTTGATTTCCTTGACCTTGAGTTCCGCGAAAGTTG
TTGGGTCATCTGCTAGGCCCAATGGGTCAAAGTACTGTCCACCTGGGTAGAGATTGTTGCCTTCACCAACTCCAGGAAGCCCATTAATTCTGAAA
CCTTCCACAAGGCCCATTAGTACAACTTGGAAGCCCAATACTGCTAAAATGCTCTGAGCATGGACAAGGTTTGGGTTGCCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203167] SGN-U579843 Tomato 200607 Build 2 157 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22913 [Download] [View] Facility Assigned ID: TSHAL34TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5