EST details — SGN-E203307

Search information 
Request: 203307Match: SGN-E203307
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C410Clone name: cLEB-3-F21
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C410 [cLEB-3-F21] Trace: SGN-T23052 EST: SGN-E203306 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203307Length: 538 bp (733 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203307 [] (trimmed) AATTCGTTGAAGGAACACCTTGATCTCCCATGGTTTTCATTAGTTCAATGGAAAAATAGTTTAAGGGGGAATATGTCAAATATACAAATAGAATG
GAAACAAAAGCCTCTTCTTAGTCCTCGTAAAGAACTAACCTGTACAACAGAACAATGAATTTCACGGGACAAATATACTATAGACAAACCATGTT
TAAAAGCCCTCAAAATACAAGATGCATAAGTTGCATTTCCTGCATAACAAAATGGCGCCCCTATACCTTGGGCTTCCATAATACTGATCCTATAA
AAAAGATCAGCTTACCTATTTTTCAGCACCTAATCTCATAAGAACCAGCTTTTGTGATATAGCGAACCCATTCAACTGTGTTGTAGCCGCTCTTT
TCCCATACCTTGAGAAAGCGAACTCGAAGTCCAGATGCCGTAAACATGGGAACCTGGAATTCCATCTGAATTGGTGGCCTAGTCCAGGACTTCTT
CTCTGCTATTGTCGAAATCAACTCCACTTCAGCACTCATTGTTGACTCAGTTTGCCCAAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203307] SGN-U596297 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23053 [Download] [View] Facility Assigned ID: TSHAK35TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5