EST details — SGN-E203410

Search information 
Request: 203410Match: SGN-E203410
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C470Clone name: cLEB-3-J18
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C470 [cLEB-3-J18] Trace: SGN-T23155 EST: SGN-E203409 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203410Length: 398 bp (595 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203410 [] (trimmed) ATATAAATATCAGCTCAATAAACTAATAGTCATAGCCAATGTCAAGAATTGAATAACAGATGTGCAGCTCGCATGAACTTAAAGTTCCAATGCCA
AAATTTTGTTTTAAGTTATGATGGCACAAGTGTATAACCAAATAACCTCATACTTGATATCGTTCTAGAAAACAATACATCATCGGATGGGGGCG
AAAATAACAAAAAACAGAAACAACACCACGCTAAGGAAAACATCTCTCCACTAAACTGATGAACATTTATGCGTGTATCTGAACAAAGGACCAAC
TTCTGTTCCAATAAATACTGCGGAGGGCCACATGTTTGTGTTGCCACTGCTCTAGCAGGGTGCAATGGAAACCTCGTATGCTCAACTTAAATTGC
CTCTTCTGAGTTTGCCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203410] SGN-U567173 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23156 [Download] [View] Facility Assigned ID: TSHAL57TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5