SGN ID: SGN-C2375 | Clone name: cLEC-15-L7 |  | Order Clone |
|
Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E203687 | Length: 232 bp (988 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E203687 [] (trimmed)
CTAAGGCTATTCACCTTGATAATGTCATTTCATGACAAACTTCTGTTGATTATTATCTATCAGTTGAAATAATAGTTGAACATCTTGTAGCTATT
TGCTCTCAAGGTGTATAGAGCTAAAAGAAAGAAGTTCTACAAAAGGAATAAGATAATGAAACTCCGGTGTGGGTGTCTGTTGTTGTAACGACAAG
CAGAGAGCAGTGTCTTCTTGGTCTGATTCATGCTTCCCCTTT
[BLAST] [AA Translate]
SGN-ID: SGN-T26788 [Download] [View] |
Facility Assigned ID: TCACG64TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 |
Expected Error Rate: 0.0204 |
Quality Trim Threshold: 14.5 |