EST details — SGN-E204301

Search information 
Request: 204301Match: SGN-E204301
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1508Clone name: cLEC-13-A15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173081 is on microarray TOM1: SGN-S1-1-2.4.20.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173081 [TUS-15-D7] Trace: SGN-T188848 EST: SGN-E374618 Direction: 3' Facility: INRA
Clone: SGN-C173081 [TUS-15-D7] Trace: SGN-T188849 EST: SGN-E374619 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204301Length: 164 bp (596 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204301 [] (trimmed) ATTCTTGAACCATGCGCTATATGACCCTGAAATTGGTTATTGCCAGCGGATGAGCGATTTGCTGTCACCCATAATTTCTGTAATGACAGAGGACC
ATGAAGCTTTTTGGTGCTTTGTTGGTTTCATGACGAAGGCTAGGCATAACTTCGGCTTGATGAGTTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204301] SGN-U567837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26054 [Download] [View] Facility Assigned ID: TCABW08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0167 Quality Trim Threshold: 20.5