EST details — SGN-E204815

Search information 
Request: 204815Match: SGN-E204815
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1955Clone name: cLEC-14-G18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173269 is on microarray TOM1: SGN-S1-1-6.4.20.15
See unigene SGN-U575556 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C173269 [TUS-15-L3] Trace: SGN-T188881 EST: SGN-E374651 Direction: 3' Facility: INRA
Clone: SGN-C173269 [TUS-15-L3] Trace: SGN-T188882 EST: SGN-E374652 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204815Length: 408 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204815 [] (trimmed) AAAATATCCAGTAAATATGTTTTGCTCAACTTGTCCAGAAATAAAATGTTAGTTCCTCTCGTGCGATGAACATAGGTTGCAACAATAAAAGCATA
CAAAAAATTCAATGGAGATAACAGGAAAGACATAATTATCCTCCTTTTCTACTGAACACCGAAAAGTAACAAAACTTGCAAAACCTGATCCTATC
AAAATCTAAATCCTGATGTTGAAGTAATCCTGGTCAAAATGATGCAATCTCACATATCCATCTTCACCACCACTTGCAAAACTTTTCCCATCAGG
ATTGAAAGCCAAAGCATTTATTGGTCCAAAATGCCCTTTGACACCTCCTATTTCTTCAGTAAGAATCTTGTCATAGAACTTGGCCTCAAACTTTC
CAGCACGATGGTCAGTAGTGGTGACAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204815] SGN-U575556 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26431 [Download] [View] Facility Assigned ID: TCACB45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5