EST details — SGN-E204879

Search information 
Request: 204879Match: SGN-E204879
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1900Clone name: cLEC-14-D6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173233 is on microarray TOM1: SGN-S1-1-2.2.20.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173233 [TUS-15-J15] Trace: SGN-T188813 EST: SGN-E374583 Direction: 3' Facility: INRA
Clone: SGN-C173233 [TUS-15-J15] Trace: SGN-T188814 EST: SGN-E374584 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204879Length: 161 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204879 [] (trimmed) AATTCATAATATTATCATTCGATTAATTATGGTAGTAGCAACTCCATCTCCCCTTATACGCCGCGGTAACAAGAAAAAAACCGCGGCGTTTGGGG
TTCCGACAATTGACTTGTCGGATGACAAGTCTATTGCGTCCGAAATGATTGTGAAAGCATGTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204879] SGN-U568917 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26495 [Download] [View] Facility Assigned ID: TCACD15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5