EST details — SGN-E205023

Search information 
Request: 205023Match: SGN-E205023
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2577Clone name: cLEC-16-H23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173436 is on microarray TOM1: SGN-S1-1-7.3.18.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173436 [TUS-16-C2] Trace: SGN-T192919 EST: SGN-E391593 Direction: 3' Facility: INRA
Clone: SGN-C173436 [TUS-16-C2] Trace: SGN-T192920 EST: SGN-E391594 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205023Length: 429 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205023 [] (trimmed) GGCCTCTTCAAAACCCCTTAAATTATAACTTATAATATCTCCAATACTTGCAAAATACAAAGGAAAAAAAAATGGTTAGTCCATCCATTAATTCC
CATAATTTTCCTCTAAAATTCCTTTGTAGCTATGGTGGCAAGATTATCCCCCGTCAAACCGATGGAAAACTCCGGTATTATGGTGGCGAAACTCG
TGTCCTCTCCGTTGATCGTTCCATTTCATTCACAGAACTATTATTGAAGCTAGGGGAGATGTGTGGATCGTCAGTGAGTTTAAGATGTCAGTTAC
CAAACGAAGATCTAGATGCTCTTGTATCGATAACATCTGACGAAGATTTAGCCAATTTAATCGAAGAATATGATCGTGTTTCAAAAATATCATCG
TTTCTCAAGATGAGGGCTTTTTTATATCCACCAAAATCCACAAAAAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205023] SGN-U571663 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26912 [Download] [View] Facility Assigned ID: TCACK48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0347 Quality Trim Threshold: 14.5