EST details — SGN-E205035

Search information 
Request: 205035Match: SGN-E205035
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2662Clone name: cLEC-16-L23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173475 is on microarray TOM1: SGN-S1-1-8.4.18.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173475 [TUS-16-D17] Trace: SGN-T196783 EST: SGN-E395457 Direction: 3' Facility: INRA
Clone: SGN-C173475 [TUS-16-D17] Trace: SGN-T199761 EST: SGN-E398435 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205035Length: 490 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205035 [] (trimmed) CAGGCCAGAAGAAGTTGCATATAACGCCCAGTGTGTTTACTTGTAATATCTTGTTGAATGCTCTCTGTAAGAAAGACGATATTAATAGTGCAACT
AAAGTTCTTGATGAGATGCCTGTGATGGGAATAGTTCCCAATGTTGTGAGCTACACAACCATTTTGGGTTGTTATGTATCACTTGGTGATTTACT
CGGCGCCAAGAGGATGTTTGATGAAATTGTTGATAGAGGGTGGTTGCCTGATGCAACGACGTACACTATCTTGATGCATGGTTATGTTAAGCAAG
GGAAGTTTATTGATGCAGCTAAGATAATGGATGAGATGGACGACAATGGGATTGGGCCAAATGAAGTGACATATGGAATTATGATTGAGGCATTT
TGCAAGGAAAAGAAGTCCGGTGAAGCTGTTAATTTACTTAACGATATGCTAGATAAGAGGTATATACCAAGCCCAACACTTTGCTCTAAGGTGAT
TGATGTCTTGTGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205035] SGN-U567209 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26924 [Download] [View] Facility Assigned ID: TCACK72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5