EST details — SGN-E206479

Search information 
Request: 206479Match: SGN-E206479
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4197Clone name: cLEC-23-O16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183835 is on microarray TOM1: SGN-S1-1-8.4.19.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183835 [TUS-43-D9] Trace: SGN-T197996 EST: SGN-E396670 Direction: 3' Facility: INRA
Clone: SGN-C183835 [TUS-43-D9] Trace: SGN-T197997 EST: SGN-E396671 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206479Length: 458 bp (922 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E206479 [] (trimmed) ATTAAGTTGTGAGATGGCAGGAGTAAAGTTGCTAGGTATTGCATTGATCCCTTTTAGTCGTGGAGTTGAGTGGGCTCTCAAAATTAAGGGTGTTG
AATATGAATTTGTTGAACAAGATTTACATAACAAAAGTCCTGTACTTCTTGAATTGAATCCAATTCACAAGAAAATTCCAGTGCTAATTACACAA
TGGCTAGCCAATTTGTGAGTCAATGGTGATTGTTGAATACATTGATGAGACATTTGAAGGTCCTTCCATCTTGCCTAAAGATCCTTATGATCGAG
CTATAGCTCGTTTTTGGGCTAAGGTCTTTGATGATAAGTGCATGCCAGTAATGGGGAAAGCTATATTTGGTAGTGGAGAGGAGTCATACAAAGCT
AAAGAGGAATCGGGTGATTTAATAAAGATTCTTGAGAATGAGCTAAAAGACAAGAACTTTTTTGATGGTGACAAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206479] SGN-U580000 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28438 [Download] [View] Facility Assigned ID: TCADL92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0237 Quality Trim Threshold: 14.5