EST details — SGN-E207558

Search information 
Request: 207558Match: SGN-E207558
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5503Clone name: cLEC-32-C1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C182097 is on microarray TOM1: SGN-S1-1-2.3.10.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182097 [TUS-38-K23] Trace: SGN-T194543 EST: SGN-E393217 Direction: 5' Facility: INRA
Clone: SGN-C182097 [TUS-38-K23] Trace: SGN-T194674 EST: SGN-E393348 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207558Length: 473 bp (732 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207558 [] (trimmed) GTTTTTTGAGCAAGATGTCGAGGTTAAGAAACAGTATTACAGTAGAGATACTACGAAAAGAGTGATTCACACTAGTAATTTTGATTTGTATAGCT
CTTCTGTTCCAGCTGCAAATTGGAGAGACACACTTTTCTGTTTAATGGCTCCTGATCCTCCAAGTCCAGAAGAACTTCCAACAGCATGCGGAGAA
ATACTAATGCAATACTCTAAGGATGTGATGAAATTAGGCTTCTCCTTACTTGAATTATTATCAGAAGGTCTTGGTCTCGATCGCTGCCATCTCAA
AGATATGGATTGCGCGGAGGGGCTAGGTATTTTGGGACATTACTATCCAGCATGCCCTCAGCCAGAACTCGCGATAGGGACCAACAAACACTCTG
ACAATGATTTTATCACCGTACTTCTACAGGATCATATCGGAGGACTTCAAGTGCTTCACCAGAATCAATGGGTTAATGTTCCTCCTACACCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207558] SGN-U579145 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29771 [Download] [View] Facility Assigned ID: TCAEU13THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5