EST details — SGN-E207595

Search information 
Request: 207595Match: SGN-E207595
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5751Clone name: cLEC-32-O23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173867 is on microarray TOM1: SGN-S1-1-8.1.18.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173867 [TUS-17-E1] Trace: SGN-T191634 EST: SGN-E390308 Direction: 3' Facility: INRA
Clone: SGN-C173867 [TUS-17-E1] Trace: SGN-T197463 EST: SGN-E396137 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207595Length: 193 bp (741 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207595 [] (trimmed) CCAAAAACCCCCATTTTAACATATGATCTTGTTTCTAATGAACATGTTAATCAAGAATCATATTTTGGGGTTGCTGGATTAACTGGGACTAACTA
CCAACTCAACTGCGCATTGAGATGGAACTTAACAGTTGAGTATTTCCCTGAAAAGAAAAATACTTGTGTTGAAGATTGTTTTACGTGTCGGGATT
CCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207595] SGN-U596257 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29808 [Download] [View] Facility Assigned ID: TCAEU96THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0214 Quality Trim Threshold: 14.5