EST details — SGN-E207953

Search information 
Request: 207953Match: SGN-E207953
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6217Clone name: cLEC-34-L5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168731 [TUS-3-O1] Trace: SGN-T627 EST: SGN-E379537 Direction: 5' Facility: Avesthagen
Clone: SGN-C168731 [TUS-3-O1] Trace: SGN-T1013 EST: SGN-E379588 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207953Length: 464 bp (828 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207953 [] (trimmed) CAAGTTTTCATTATTTGTCTGGATAATGAGTTGACGTGATAATGAGTAGACTCTCATTTAGGCCACGCCCACTTGACATTCACAAGAAGTTACCT
ATTGTAAAATCTGTAAAGGATTTTGAAGATGATGATTCACAGTCCAATACCCGCAATCAAATCATTCGTCTAGCTGCCGAAGCGGCAGATATTGA
GCCCGAGCCGAGATTGGAGAATTTGTTGAGTACGATCTTGACAATGAGGATGAAGATTGGCTTCAAGACCTAAACAGAGAGAGGAAGGCTCTTGC
AGCTGAAAAGTTGGAGACCATTCTGCACAAATTAGAGGTGTTAGATCACAAGGCCCGAGAAAGAGCAGGAGTGATTACTCCTACTCTTAACTCAC
CTATCCCGGTGCTTCTAAGTTTCGATGCTTCTGTTGAGGCATTGCAATCTCTAACAATCAAATATGGAGTTTTCCAGTCAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207953] SGN-U585542 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30397 [Download] [View] Facility Assigned ID: TCAFE63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5