EST details — SGN-E208248

Search information 
Request: 208248Match: SGN-E208248
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7030Clone name: cLEC-37-J17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174115 is on microarray TOM1: SGN-S1-1-8.3.17.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174115 [TUS-17-O9] Trace: SGN-T1303 EST: SGN-E378157 Direction: 5' Facility: Giov. Lab
Clone: SGN-C174115 [TUS-17-O9] Trace: SGN-T191459 EST: SGN-E390133 Direction: 5' Facility: INRA
Clone: SGN-C174115 [TUS-17-O9] Trace: SGN-T197503 EST: SGN-E396177 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208248Length: 292 bp (679 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208248 [] (trimmed) CCCAAAAAAAATTAGAAAATTCCAATTCGTAAAGATAAATTTTTTAATTTAATAATCAACGTAAATGAGTTTGAAATATAGCTAAAAATATTTTT
TTCTTTTTAATTAAAAATAACAATTAATTTTTATTTTTTTCTCCTCTGCCCCCATGGATTCAATTACCACCTCAGCTTTGTGGGAAAATACTTTT
CGATAAAAAAGAGATAGTATGGCTTGACTTTTTCCACATCAATTCGAACTTTACTCTTGCTATATAAATCATATTTATTAAAAATGTTGAGCCAC
TTCATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208248] SGN-U565448 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31239 [Download] [View] Facility Assigned ID: TCAFQ57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0