EST details — SGN-E209156

Search information 
Request: 209156Match: SGN-E209156
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7207Clone name: cLEC-38-D15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174187 is on microarray TOM1: SGN-S1-1-8.2.16.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174187 [TUS-18-B9] Trace: SGN-T197212 EST: SGN-E395886 Direction: 5' Facility: INRA
Clone: SGN-C174187 [TUS-18-B9] Trace: SGN-T199849 EST: SGN-E398523 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209156Length: 411 bp (909 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E209156 [] (trimmed) GCCATTTTTACACCTTCACTCTCTACTCTAAACCCTAACGTCTCTCTCCTTCAACACTTCGATTCAGACGACAAACCCTAATTTCAGTTAATTTT
TTGGTATTCTTTAGTTCTGACAGTTGATTTTAATGGAGGAGAATCAGAAGCAGCAGCAATTTTTGGTTTCATCTGTATCGGAGCTTACAAGTTCT
TCATCTTCGTTGTTTTCCAAAACCGAACCGGTTTTTGCTCGGTTTAGCTTAGATTCCGGTTTGCCGGAGCTCCGATTTGGTCAGGGTGCAGAGCT
GAGTGATGCCGTGGTGTTCAATGTTAAGATTTCTCAGTTATTCAAGCTAGGTCCTGTTGAATCCTTATGCGTATCTGAAGCCAATAAAGAGAAAT
CACATTCAAGGGGAATCTCCATTCAATTTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209156] SGN-U567452 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31691 [Download] [View] Facility Assigned ID: TCAFU20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5