EST details — SGN-E209212

Search information 
Request: 209212Match: SGN-E209212
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7421Clone name: cLEC-38-N8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174240 is on microarray TOM1: SGN-S1-1-3.4.16.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174240 [TUS-18-D14] Trace: SGN-T199866 EST: SGN-E398540 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209212Length: 474 bp (974 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E209212 [] (trimmed) GTCAAACAGGACATAAAGATTAAAGCTAGTGAAGAAGGTTTTGTTGAAGATATAAATGATCTTAAGGTTGAAAAGGAGAGAAAATCAATACATAA
CGAGGACGATAATTCGAAGTCCTCTCAGCAAAAGGATCTCACTGGGGACAAAAAGGACGATCAGCTGGAATCAGCCAAAGCCGATATGGAAGAAG
TAATGGAAGAAAATCAAAGGCTAAAGAAACACTTAGATAAAATCATGAAGGATTATCGGAATCTTCAAATGCAATTCCATGAAGTTGCACAAAGA
GATGCTGAAAAAACTAATACTGATGTTAAACATGACGAAGCTGAACTTGTTTCCCTTAGCCTAGGAAGGACTTCAAGTGACACAAAAAAGGAGTT
ATCCAAATTAATTTTGAGCAAAACAGAGAATGATGAGAAGGAAGAAGATAACCTAACCCTAGCATTAGATTGCAAGTTCAATCATCGACCAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209212] SGN-U571278 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31747 [Download] [View] Facility Assigned ID: TCAFV76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5