EST details — SGN-E209478

Search information 
Request: 209478Match: SGN-E209478
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C9156Clone name: cLEC-54-M19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209478Length: 263 bp (1133 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E209478 [] (trimmed) GGTATCACTTGTAAATATCAAAAATCTTAGTTCTCAACTATGGGTGGTGACAATACTGAGAAGATTACCATAATGATGCTAAAGGTTGATCTTCA
ATGATCAAGCTGCTACAAAAAAGTCAAAAAATTCTCTGCAAATTCCCTCAAATTCGAGACCAAGTGTATGATGAAAAGGCCAATATAATCACAAT
TACTGTATTGGGGGGCAAACCTGAAAAAATTCGGGACAAATTGGGTTGCAAAGGAGGGGGAGGAATCAAGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209478] SGN-U590167 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32787 [Download] [View] Facility Assigned ID: TCAIE82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0287 Quality Trim Threshold: 14.5