EST details — SGN-E210019

Search information 
Request: 210019Match: SGN-E210019
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7900Clone name: cLEC-40-J6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174312 is on microarray TOM1: SGN-S1-1-3.3.16.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174312 [TUS-18-G14] Trace: SGN-T189199 EST: SGN-E376585 Direction: 3' Facility: INRA
Clone: SGN-C174312 [TUS-18-G14] Trace: SGN-T189200 EST: SGN-E376586 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210019Length: 495 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210019 [] (trimmed) GCTTGTCCTGCTTCTCCAGTTCACTACAAGTATAATCCTGTCAAAACTATTAAGACAAATGTGATGGGCACCCTTAACATGTTGGGGCTTGCCAA
GAGAATTGGTGCTAAGTTCTTGCTTACCAGTACAAGTGAGGTTTATGGTGATCCGCTTGAGCATCCTCAAAAGGAAACATATTGGGGTCATGTGA
ATCCAATAGGTGTTAGGAGCTGCTATGACGAGGGAAAACGGACTGCGGAAACCTTGACTATGGATTACCATCGCGGTGCAAATGTCGAGGTTCGT
ATTGCTCGGATTTTCAATACATACGGACCTCGTATGTGTTTAGATGATGGACGTGTTGTCAGCAACTTTGTTGCGCAGGCCATCCGCAAGCAACC
AATGACAGTATATGGGGATGGAAAGCAAACTCGAAGTTTTCAATTCGTCTCTGATCTGGTTGATGGATTAGTGGCCCTCATGGATGGTGAGCACA
TTGGCCCTTTCAACTTGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210019] SGN-U573646 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32083 [Download] [View] Facility Assigned ID: TCAGD51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5