EST details — SGN-E210073

Search information 
Request: 210073Match: SGN-E210073
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7791Clone name: cLEC-40-E2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C182088 is on microarray TOM1: SGN-S1-1-3.3.10.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182088 [TUS-38-K14] Trace: SGN-T194812 EST: SGN-E393486 Direction: 3' Facility: INRA
Clone: SGN-C182088 [TUS-38-K14] Trace: SGN-T199350 EST: SGN-E398024 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210073Length: 210 bp (647 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210073 [] (trimmed) GTTGCTCCCAATGCGGCGTTCTTAGTCATGGGCCTGAAACAACTCACTGTGTGGAATTTACTCGAATTAGCTTTCCTGTTCCCGTACAAGTTGCG
CAAGTTTCAGCTTCTCATAATCATGCTGCTTTTGTCACAGGGTCTGGACAGGTGTTCACATGTGGAGATAACTCATCATTCTGTTGTGGGCATAG
AGACACTGGACGCCCAATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210073] SGN-U572215 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32137 [Download] [View] Facility Assigned ID: TCAGB25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5