EST details — SGN-E21017

Search information 
Request: 21017Match: SGN-E21017
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C30877Clone name: cLEG-10-J12
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C30877 [cLEG-10-J12] Trace: SGN-T65789 EST: SGN-E251199 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E21017Length: 653 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E21017 [] (called/trimmed by facility)
CCGCCTCCGGCCACACTCTTAATTTATCGTCCTAGGGTTTTCAGTCGCCGGAAAAGAAATTCGATTTTCCGACGAATCTATCGAGGTGATTGAGG
ATTTGGATGAGAATACAAGATGCCGCCAAAGCAATCTAAAGCCGATATTGCAAAGAAGCAGAAGGTAGTTGAAGACAAGACGTTCGGTCTTAAGA
ATAAGAACAAGTCGAAGAATGTTCAGAAATATGTTCAGTCTTTACAGCAAAATGTTGTGCCTAAAGCTGATCCTAAGAAACTTGACGCCAAGAAA
AAGAAGGAAGAAGAGAAAGCTAGAGAGAAAGAGCTTAGCGAATTGTTCAAAGTCGCTATTAGCCAACCTAAAGTGCCTCTAGGTGTTGATCCAAA
ATCTATTTTATGTGAGTTCTTTAAGGCGGGGCAATGTGTTAAGGGTTTTAAGTGCAAGTTCTCTCACGATCTGAATGTTCAGCGAAAAGGAGAGA
AGATTGATATTTTCAGCGATAAGCGTGATGAAGATGGAAAGGAAACAATGGACGATTGGGATCAAGAGACACTGGAGAAGGTTGTGGCGTCAAAA
AGTCAAGAGTATAACAAGAACAAACCAACTGACATTGTAAGCGTTGTCCTTTTCCATAATATACCTTGTACAGTACATACTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T65789 [Download] [View] Facility Assigned ID: TBFBN54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence