Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E210196

Search information 
Request: 210196Match: SGN-E210196
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7992Clone name: cLEC-40-O7
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174336 is on microarray TOM1: SGN-S1-1-3.4.16.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174336 [TUS-18-H14] Trace: SGN-T199871 EST: SGN-E398545 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210196Length: 604 bp (878 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E210196 [] (trimmed) GCTTTACAAACTGACCAATTCTTTTCTTCTTTTAACTTGCTAACAGTCATATGATATGCCTCAATAAATCAGAAGTATTCTGTACAAAATAATCA
CACCACAACTATTATGAACAACCTAACCTAAGATACACATGGTGTACAAAATAATCACAGTTTCTTTGGCAAGTTGTATTTCTTCTTTAGAAACT
TAGAAGCAATTTTATCATTTCGATAACACAGAACACGCATAATGGTGCTGAGCTCAGTTGGACTCCAGTTACCTGATGTAGGAGGCAAGGGAAGT
CTGGATTTAGCTGAAGTGCCAAAATTATCTTCAGTGGCATGTTCAAGTTGCTCAATCAGAATAGCGGTATCAGTATGGAAAAGAGGAAGAATGCC
TTTCAAAGTAGCTGAATACTTGTCTATAAGGTCAGTCGGTAACCCATCCCCATCAGACCAGAATAGATCCATTAGGAACTTTAAATCTTCATCTA
TAATTGCAGCATCAGCAAGTGAAAAAGCACGACAAGGTCCTCCAGCCAACAAAATCAACAAGAATCCATCAAAAGAGGCTTTCATTACATTAGTG
ATAGCACGTGTCCGGACCCTGTCATGAACTGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210196] SGN-U570263 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32260 [Download] [View] Facility Assigned ID: TCAGA88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0