SGN ID: SGN-C7976 | Clone name: cLEC-40-O10 |  | Order Clone |
|
Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: Alias clone
SGN-C174330 is on microarray TOM1: SGN-S1-1-1.4.16.14
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E210209 | Length: 220 bp (655 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E210209 [] (trimmed)
CCTGGAGCTCCAAATCCTCCACCCAGAGGCCCACCATCTGGATCAATGCCTCCACCCCCTCCCCTTATGGGTAACGGACCTAGACCTATGCCACC
AGGAGGTAACTTACCTGCCCCACCACCTCCTCCCGTTGGTGGTGGAGCTATGGCTAATTTCACTCCAAGTGGACACATGGGTAGACCTCCAATGA
TGCCTCCACAAGGTTTTCCAGGTCAACAAC
[BLAST] [AA Translate]
SGN-ID: SGN-T32273 [Download] [View] |
Facility Assigned ID: TCAGB89TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 |
Expected Error Rate: 0.0544 |
Quality Trim Threshold: 12.5 |