EST details — SGN-E210485

Search information 
Request: 210485Match: SGN-E210485
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6562Clone name: cLEC-35-M8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181898 is on microarray TOM1: SGN-S1-1-1.3.10.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181898 [TUS-38-C16] Trace: SGN-T194785 EST: SGN-E393459 Direction: 3' Facility: INRA
Clone: SGN-C181898 [TUS-38-C16] Trace: SGN-T199345 EST: SGN-E398019 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210485Length: 638 bp (855 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210485 [] (trimmed) GTTCTCCCCGTGACAATAAATTTGACAATTACGCCTCTGATGGCAATGTTATTGACCAAAGTTTCAATTCCTATAGCACAAGTACTGCTGGAGGT
TCAGGCAAATTCACAAATTACGCGGCGAATGCCAATGACCCCAATCTGCATTTCACTTCCTATTCCGATCAAGGAACAGGAGGTGTACAGAAATT
CACAATATACTCACAAGAAGCCAATGCTGGTGACCAGTATTTCAAAAGTTACGGCAAAAATGGGAATGGTGCTAATGGTGAATTCGTCAGCTATG
GAAATGACACAAATGTTATCGGCTCAACATTTACAAATTATGGTCAGACAGCAAATGGGGGAGACCAAAAATTCACATCTTATGGTTTCAACGGC
AATGTTCCTGAAAATCATTTCACCAACTATGGTGCTGGAGGTAATGGTCCATCTGAAACTTTTAATAGTTACAGAGATCAATCGAATGTTGGAGA
TGACACATTCACTACCTATGTTAAGGATGCAAATGGCGGTGAAGCGAATTTCACCAACTATGGTCAATCATTCAATGAAGGTACTGATGTATTCA
CTACTTACGGCAAAGGGGGTAATGACCCACATATCAATTTCAAAACTTACGGAGTTAACAACACTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210485] SGN-U586540 Tomato 200607 Build 2 101 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30833 [Download] [View] Facility Assigned ID: TCAFH76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5