EST details — SGN-E215060

Search information 
Request: 215060Match: SGN-E215060
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C13655Clone name: cLEC-78-I12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E215060Length: 634 bp (907 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E215060 [] (trimmed) CAAACCCGATGAGCTATTATCCACCACGCTGGTTTCTCCAAATGTTTCCTAATTGGCTCGAGTGCCGGAGTCAACGTGGTGTACCATGTGGGCCT
ATGCGCCGCGGAGAGTTGGGACAACCTCAAGCCTTTGGAAATCAAGGGGTTGATATTGACTCAACCTTTCTTTGGTGGGAATGAGAGGACACAAT
CAGAAGTAATATTGGTTACCCCCAATTGTAAATGATATCACGTGGGACCTAGAATTGCCTCAAGGTGCTGATCGCGATCATGAGTATTCAAATCC
AATTGTGGGGATTAAATCTAAATCCGAACCTATTTGATCAAGTAAAATTATTGGGGTGGAAAATGTTGGTCACTGGATCTGATGACGATCCTTTA
ACTGACCGCCAGGTTGACCTTGTAAGGGTATTGAAAGAATTGGGCGTTCAAGTAGAAGGTAGATTCACTCAAGGAGCATATCACGGGTCCGAGAA
TGCTGATCCTTTGAAAGCTAAAGAATTTTCCTTGCTTGTAAAGGAATTTATAAGTCACTTATAACATCATATTTACAATATATATATATATATAT
ATATATATATATAAATTTTACTTTATGTGTACATATATAATATTGAACCCTCTAAACATAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E215060] SGN-U598348 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T37482 [Download] [View] Facility Assigned ID: TCALX54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5