EST details — SGN-E216462

Search information 
Request: 216462Match: SGN-E216462
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53871Clone name: cLEL-1-K17
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53871 [cLEL-1-K17] Trace: SGN-T2662 EST: SGN-E217146 Direction: 3' Facility: Cereon
Clone: SGN-C53871 [cLEL-1-K17] Trace: SGN-T20616 EST: SGN-E281432 Direction: 3' Facility: Novartis
Clone: SGN-C53871 [cLEL-1-K17] Trace: SGN-T20617 EST: SGN-E281238 Direction: 5' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216462Length: 98 bp (575 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E216462 [] (trimmed - flagged) AAATCGATGGGCCCGCGGCCGCTCTAGAAGTACTCTCTCTCTCTCTCTCTCTCTCTTTTTCTCTCTCTCTCTCTCTCTCTTTGTGTCTATGTCTC
TGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T1978 [Download] [View] Facility Assigned ID: cC-esflcLEL1K17c1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0