EST details — SGN-E216612

Search information 
Request: 216612Match: SGN-E216612
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53688Clone name: cLEL-1-C3
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53688 [cLEL-1-C3] Trace: SGN-T2420 EST: SGN-E216904 Direction: 3' Facility: Cereon
Clone: SGN-C53688 [cLEL-1-C3] Trace: SGN-T20553 EST: SGN-E281203 Direction: 3' Facility: Novartis
Clone: SGN-C53688 [cLEL-1-C3] Trace: SGN-T20554 EST: SGN-E281404 Direction: 5' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216612Length: 494 bp (581 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E216612 [] (trimmed) CATTGAAATGTTGCAATGTATCAGCAAATTACTAGTCTCAAACAAAGAACCATTCAGTATCCACTGTTCTCATCAAAATTGCAGTAAAACAAAAG
TACTAGTATTACTAGAAACCATGTAGACAGATTTGGATGAATCACTTCAATGGAATGAACCTTGAAGAGTGAGTAGCACCAATACCGGGCCTACC
GTGCTTGACAGGCTTGTATGAGATGGAGAACTCAGCTAAGTAGTGACTAATCATCTCAGGCTTGACCTCAATTTGATTGAAAGTTTTTCCATTGT
AGATTCCAATGACACTTCCAATCATCTCAGGAACAATGATCATGTTCCTCAAATGTGTTCTCACAACCTCTGGCTTCTCACCAGGTGGGGCCTCA
CGTTTCGCCTTGCGCAGCTTCTTGATCAAAGCCATAGGCTTCCTCTTCAAACCCCTCTGGAACCTTCTGCGAGGACGAGCAGGGTAAAGCTTAAC
AAGCTCATCAGTAGACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E216612] SGN-U577715 Tomato 200607 Build 2 166 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T2128 [Download] [View] Facility Assigned ID: cC-esflcLEL1C03c1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0132 Quality Trim Threshold: 14.5