EST details — SGN-E217150

Search information 
Request: 217150Match: SGN-E217150
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53910Clone name: cLEL-1-L9
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53910 [cLEL-1-L9] Trace: SGN-T1982 EST: SGN-E216466 Direction: 3' Facility: Cereon
Clone: SGN-C53910 [cLEL-1-L9] Trace: SGN-T20797 EST: SGN-E281537 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E217150Length: 333 bp (657 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E217150 [] (trimmed) GGAAAAATAGAGATAAAGAGAATAGAATCCACAAACAACAGGCCAGTAACTTATTCAAAAAGAAGAAATGGTATAATAAAGAAAGCTAAAGAAAT
TACTGATCTTTGTGAAGCTAAGGTTTCACTTATAAGCTATGCTAGATCTGGAAAGATGCATGAATATCGTAGCCCTTCTACTACGATAAGTGATA
TGTTGGATGGTTATCAAAAAGCTTCTGGGAGGAGACTATGGGATGCTAAGCATGAGAATTTGAGTAATGAAATCGATAGAATCAAGAAAGAGAAT
GACCGTATGCACCGTTAAGCTCAGGCACCTCAAAGGAGAAGATATCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E217150] SGN-U573183 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T2666 [Download] [View] Facility Assigned ID: cC-esflcLEL1L09b1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0262 Quality Trim Threshold: 14.5