EST details — SGN-E217608

Search information 
Request: 217608Match: SGN-E217608
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C55433Clone name: cLEL-25-M7
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C55433 [cLEL-25-M7] Trace: SGN-T11688 EST: SGN-E217744 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E217608Length: 434 bp (926 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E217608 [] (trimmed) AAAAATTAACTAGGGGCACGCAGCATACATTTATGAGACACCAAAACATTCCTGTATACAATTTGTTCGCTCTGTTCATGAGTACTGCATATGGA
AAAGATATCCTCGTTATACTTGATTAAATCTAAACAATGTGCAAGAGCATATGTCAAAACAATTTTTAGCAGGCTTTCAAGCCTGCTCCTTCTCA
CGAATTGCCTTATAGCACTGGAGACTGCAAAGAGGAAGTTTTGTCTTAGAATCACGATACTTGTACGGATTCACGCAGGAAGGACCAGCACATTG
CTCACGAGGGGGAGGATAACTGCAAGGTTTAGAGTCAAAAATATGAGGTAAACCCATATCTTCAGGAAATGTCACAACAGTGCCGGTAGGGCCCA
TAACCACTCTGATAGTGCTTTTTGCAAGCATCTGCTCTTTGGCAGCCTTCTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E217608] SGN-U574331 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T11552 [Download] [View] Facility Assigned ID: cC-esflcLEL25M07d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5