EST details — SGN-E217635

Search information 
Request: 217635Match: SGN-E217635
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C55389Clone name: cLEL-25-G13
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C55389 [cLEL-25-G13] Trace: SGN-T11619 EST: SGN-E217675 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E217635Length: 302 bp (846 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E217635 [] (trimmed) GGCCAAACTGGGCATGGGTTTTGCCAAAAAAATTAGCAAAGCCAAAAATTCAAGGGCAAGAAACTGGGGATTTCTAACTTTCAACCGATGGAAAA
GGGAAGCAGGACCTCCATAAAAATATTTTTAGGGGGATCCCCGGGGAAGTCAATTTTACTATAAACGATCTTTTTCCCACTTTCCAATTTTAAAA
AGAATAATCAATTTTTTTCACAGGTGGGCTTTTTTAACCCTATCCCTGCACAGTTTGTTGCCCACCCCCCCCCTGAATGGGCATCCCTGGGCCGG
GATGATGGCCCATGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E217635] SGN-U587325 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T11579 [Download] [View] Facility Assigned ID: cC-esflcLEL25G13a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.876 Expected Error Rate: 0.0250 Quality Trim Threshold: 12.5