EST details — SGN-E218423

Search information 
Request: 218423Match: SGN-E218423
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53235Clone name: cLEL-18-P6
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E218423Length: 386 bp (561 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E218423 [] (trimmed) GCCAAACTTTCAACATGAAAATCATTAATTACATGTCATATATCTATTTTATATATGTGGTACATAACAATATTTAAAACCTCTTACCATAGGTC
TAAACTTTTCTTTACCCTTAATAATGCAAAGAAAAATTAACCTATATAAAATGACCATCCCAAAAACAATAACAATATTTCCCCACTTAGAATAA
TTTAATTCTACTTGAAAAATATCTCTCAATATTTCATCACGAGTAACTCTTATAGCCAATCCACTATTTGCAAAATATGTAAAAGTTTCAAATTC
ATTTTTATAAAAACCTTGAATTGCATATTTGCGGAAGGATAGATAGTACAATGGATATTTCCAAATTGGCATTGGAAGTTCATTTGGCAATCGAA
AAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E218423] SGN-U598306 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T7855 [Download] [View] Facility Assigned ID: cC-esflcLEL18P06d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.896 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5