EST details — SGN-E22001

Search information 
Request: 22001Match: SGN-E22001
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105111Clone name: cLPP-17-B23
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C105111 [cLPP-17-B23] Trace: SGN-T176861 EST: SGN-E365149 Direction: 5' Facility: TIGR
Clone: SGN-C194762 [TUS-71-K16] Trace: SGN-T348541 EST: SGN-E547666 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E22001Length: 404 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E22001 [] (called/trimmed by facility)
GATTAATAGTCGCAATGCAAAACTTTGGTAGTCGTCTCATTGATTGATCTACCAGCCCCCAGCAGCAGGAGGAGGAAATTGTGATGATGAAAACT
ACAAGTCATTGTGTTCCATATGTCTATCTGAATATGTAAAGGACAACACAATTGGTACACTCGGTTGTGGACATGAATATCACGCAACTTGCATA
CAACAATGGCTGCTGAGGGGCAAGAAGAATTGTCCAATCTGTAGATCTTCTGTTTAACAGAAACTTTACTTTTCTTTTTATCAAGTTGTTGTTAT
TTGAACTTTTTAATATGAACAATTTTTTATTCAGTTTGCTATTTTTTATATGTATTGTTGGTGATTGAATTCACCTTCTAGAACAATTCTGCAAC
TCAATTTATGGAATTATTCTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T176861 [Download] [View] Facility Assigned ID: TPOCO12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence