SGN ID: SGN-C59215 | Clone name: cLEL-4-O7 |  | Order Clone |
|
Library Name: cLEL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E229672 | Length: 68 bp (855 bp untrimmed) |
Status: Current Version | Direction: 3' |
>SGN-E229672 [] (trimmed - flagged)
AAATTAAAGTTTCGAAACAAAATTCATAATTCTCAAATAAATAATGTGTCTATTGATCTTGACTACTG
[BLAST] [AA Translate]
SGN-ID: SGN-T16578 [Download] [View] |
Facility Assigned ID: cC-esflcLEL4O07d1
|
Submitter: Koni |
Sequencing Facility: Cereon |
Funding Organization: National Science Foundation