EST details — SGN-E229672

Search information 
Request: 229672Match: SGN-E229672
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59215Clone name: cLEL-4-O7
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59215 [cLEL-4-O7] Trace: SGN-T21522 EST: SGN-E279244 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E229672Length: 68 bp (855 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E229672 [] (trimmed - flagged) AAATTAAAGTTTCGAAACAAAATTCATAATTCTCAAATAAATAATGTGTCTATTGATCTTGACTACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T16578 [Download] [View] Facility Assigned ID: cC-esflcLEL4O07d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: Too short after trimming low-quality bases
Sequence Entropy: 0.000 Expected Error Rate: 0.0159 Quality Trim Threshold: 20.5