EST details — SGN-E231067

Search information 
Request: 231067Match: SGN-E231067
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23322Clone name: cLED-5-B2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174629 is on microarray TOM1: SGN-S1-1-6.4.15.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174629 [TUS-19-D19] Trace: SGN-T189418 EST: SGN-E376804 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231067Length: 354 bp (470 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231067 [] (trimmed) AGAATATGAGATTACCTACAAATAATGAGAGTTTGAGAGTTGGAAATGAAGTAGAGTGTGAAAATGGTTGTTTGGAGGATTGTGATTGTGTTGGT
TATGCTTATGGTAATGGAAATATTGGGTGTTTGATATGGAAAAGGGAGATGTTGAATTTGCAACAACTTGCTCAAGATAATGTTAATGGAAGCAC
CATTTATGTTAGGCTTGCATCTTCTGAGTTTTCAAGTAACCAAGATCAAAAGCAAACTTCAACAAAGCTGAAAATTGCAATTCCTATAGGTGTAA
TTGCTGCACTTCTCATTCTATCATGCTTTTTTATATACTATAGAAAAAGAAGAAACTCAAAAGTCAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231067] SGN-U569967 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49683 [Download] [View] Facility Assigned ID: TOVAT01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5