EST details — SGN-E231473

Search information 
Request: 231473Match: SGN-E231473
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23067Clone name: cLED-4-G2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174453 is on microarray TOM1: SGN-S1-1-6.1.16.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174453 [TUS-18-M11] Trace: SGN-T197133 EST: SGN-E395807 Direction: 5' Facility: INRA
Clone: SGN-C174453 [TUS-18-M11] Trace: SGN-T197201 EST: SGN-E395875 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231473Length: 489 bp (1432 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231473 [] (trimmed) CAGCTTAGATCCGCCATTGCTTAGTTGATTGACTATCTAAAGACGTCTGATTTTATATAAAAATATGTCATGTTTCAATGCAGGGAGTCATTAAT
AGACTTCTCCAAGGATGTGAAGAAACTGGGATTCACTTTACTTGAATTATTGTCTGAAGGTCTCGGTCTCGATCGTAGTTATCTCAAAGATTATA
TGGATTGTTTTCATCTTTTCTGTTCTTGCAACTACTACCCACCATGTCCTCAGCCAGAACTCACCATGGGCACCATTCAACATACCGATATTGGT
TTTGTAACGATCCTTCTACAAGATGATATGGGAGGGCTCCAAGTTCTTCACCAGAATCATTGGGTTGATGTTCCTCCTACACCCGGTTCTCTAGT
GGTGAATATTGGAGATTTTCTGCAGCTCTTGTCAAATGACAAGTACTTAAGTGTCGAGCACAGAGCAATCTCAAACAATGTTGGATCAAGAATGT
CAATCACGTGCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231473] SGN-U580508 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49242 [Download] [View] Facility Assigned ID: TOVAN37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0063 Quality Trim Threshold: 12.5