EST details — SGN-E231516

Search information 
Request: 231516Match: SGN-E231516
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C23006Clone name: cLED-4-D7
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174407 is on microarray TOM1: SGN-S1-1-4.3.16.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174407 [TUS-18-K13] Trace: SGN-T197129 EST: SGN-E395803 Direction: 5' Facility: INRA
Clone: SGN-C174407 [TUS-18-K13] Trace: SGN-T197197 EST: SGN-E395871 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231516Length: 551 bp (788 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231516 [] (trimmed) CAGGAAGAAGAAGGATAAAGAGAAGAAAGACAAGAACAAAGAGTTGTCGGAAGAAGAAGATAATGAAGAGAAGGATGATAAAGTAGGCAAGAAGA
AGGATAAAGAAAAGAAAGTCAAGGCGAATGCCGCTGAAGTCGCCACAAGAGAGCTAGAAGTTGAGGAAGACAAGAAAGTATCCGACGATGAATCA
GAAGAGAAAAGTAAAAGCAAGAAGAAGGGGAAGGAAAGTAAGGATGAAAAACAAAAGGATTCAAAAAAGGATAAAGCTGAGAAGAAGAGAAAACT
CGAGGACAAGTATAAAAGCAAAGATCTGAGTAAGTTGAAATCCAAGTTGGATAAGATCAATGCCAAACTGGAAGCTCTTCAGCTGAAAAAAGCAG
ACATCCTGAAGACAATAAAAGAAACAGAAGATAAGAACTTAGCAGTGGTTGAGAGTCCCAAAGATGCTGAATCGAAGGCACACGACTAGTAGTCG
CTGAAAGTGAGTAGTATATTTTCACAATACTGTTATGTATACTAATACAGNGTTTGTGTATCCTTTCTCTTCCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231516] SGN-U578377 Tomato 200607 Build 2 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49285 [Download] [View] Facility Assigned ID: TOVAO16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.900 Expected Error Rate: 0.0165 Quality Trim Threshold: 12.5